Главная
страница 1
На правах рукописи

УДК 597.08.575.1

ПЕРЕТОЛЧИНА ТАТЬЯНА ЕВГЕНЬЕВНА
МИКРОЭВОЛЮЦИОННЫЕ ПРОЦЕССЫ В ГРУППЕ ВИДОВ БАЙКАЛЬСКИХ ЭНДЕМИЧНЫХ ГАСТРОПОД РОДА BAICALIA (MOLLUSCA, CAENOGASTROPODA)

03.00.15 – генетика

Автореферат

диссертации на соискание ученой степени

кандидата биологических наук

Новосибирск

2008

ПЕРЕТОЛЧИНА ТАТЬЯНА ЕВГЕНЬЕВНА
Работа выполнена в лаборатории геносистематики Лимнологического института СО РАН.

Научный руководитель: доктор биологических наук

Д.Ю. Щербаков

Лимнологический институт СО РАН, г. Иркутск


Официальные оппоненты: доктор биологических наук

проф. П.М. Бородин Институт цитологии и генетики СО РАН, г. Новосибирск


кандидат биологических наук Н. Л. Белькова

Лимнологический институт СО РАН, г. Иркутск


Ведущее учреждение: Институт систематики и

экологии животных СО РАН, г. Новосибирск

Защита состоится: «_12_»__марта__2008 г. на утреннем заседании диссертационного совета Д-003.011.01 в Институте цитологии и генетики СО РАН в конференц-зале Института по адресу: 630090, г. Новосибирск, проспект Лаврентьева, 10, тел. (383) 333 1278, e-mail: dissov@bionet.nsc.ru

С диссертацией можно ознакомиться в библиотеке Института цитологии и генетики СО РАН.

Автореферат разослан «____» ____________2008г.
Ученый секретарь

диссертационного совета,

доктор биологических наук А.Д. Груздев

ВВЕДЕНИЕ

Актуальность работы. Методы молекулярной биологии и популяционной генетики, включающие сравнительный анализ гомологичных нуклеотидных последовательностей уже более десяти лет применяют для исследования внутривидового полиморфизма. В настоящее время достаточно мало известно о механизмах видообразования и репродуктивной изоляции, несмотря на простоту оценки внутри- и межпопуляционного полиморфизма на молекулярном уровне (Avise, 1994). При использовании филогенетических подходов для анализа генетического полиморфизма популяций появилась возможность изучения их эволюционных историй (Vigilant et al., 1991). Относительная легкость определения нуклеотидных последовательностей ДНК дала возможность отдельно анализировать синонимический и несинонимический полиморфизм, и, таким образом, изучать как адаптивную, так и неадаптивную эволюцию на молекулярном уровне. В качестве объекта исследования выбрали группу эндемичных видов моллюсков рода Baicalia Martens, 1876 из сем. Baicaliidae. Биологическая и экологическая изученность этих моллюсков, а также их широкое распространение и низкая скорость перемещения по периметру водоема, дают уникальную возможность для изучения сценариев видообразования в оз. Байкал.

В Байкале к настоящему времени обнаружено 179 видов моллюсков, из которых 41 принадлежат эндемичному семейству Baicaliidae (Sitnikova, 1994). На протяжении более чем столетней истории изучения байкальских моллюсков их таксономия неоднократно пересматривалась. Современная классификация построена на таких морфологических признаках, как – особенности строения раковины и радулы и анатомии женской половой системы (Dybowski, 1875; Lindholm, 1909, 1924; Кожов, 1951; Ситникова, 1991). Для семейства Baicaliidae характерно большое разнообразие форм и скульптуры раковин, многим видам свойственна высокая степень морфологического внутривидового полиморфизма (Кожов, 1936). Большой размах внутривидовой изменчивости серьезно затрудняет и видовую идентификацию, и, следовательно, систематику этой группы. Сравнение нуклеотидных последовательностей митохондриального гена, кодирующего первую субъединицу цитохром оксидазы, свидетельствует об исключительно быстром процессе видообразования при адаптивной радиации от общего предка, существовавшего, предположительно, 3,0-3,5 млн. лет назад (Зубаков и др., 1997; Щербаков, 2003).

Наличие множества переходных форм особенно ярко выражено у представителей рода Baicalia. Из всех видов этого рода наиболее изменчивым оказался вид Baicalia carinata W. Dyb., 1875, который, в то же время, является одним из наиболее широко распространенных в озере (Кожов, 1936). Представители этого вида обитают как в открытых частях Байкала, так и в бухтах на глубинах от 5 до 100 м и населяют песчаные или песчано-илистые грунты. Самки этого вида откладывают яйца на раковины других моллюсков своего вида.

В 1914 году Ж. Грохмалицкий и Б. Дыбовский (Dybowski, Grochmalicki, 1914) описали 10 внутривидовых форм B. carinata. М.М. Кожов (Кожов, 1936) считал выделенные предыдущими авторами вариететы экологическими формами одного вида. Только для одной из форм, отличающейся от других наличием слабо выраженных поперечных складок на раковине, М.М. Кожов предложил сохранить подвидовое название Baicalia carinata rugosa, данное В.А. Линдгольмом (Lindholm, 1909).

Описанные выше особенности каринат делают их исключительно интересным объектом исследования микроэволюционных процессов. В этом качестве каринаты обладают рядом преимуществ даже по сравнению с цихловыми рыбами Великих африканских озер, которые относятся к наиболее популярным объектам для исследования моделей микроэволюции. Каринаты также принадлежат к букету видов (Brooks, 1950), населяют почти непрерывную зону по периметру озера Байкал, образуя систему популяций, которые в первом приближении можно считать одномерными, но, в отличие от рыб, моллюски никогда не отрываются от дна, что очень сильно ограничивает их латеральную относительно шельфа миграцию.

Цель и задачи исследования:

Цель настоящего исследования состояла в изучении генетической дифференциации видов рода Baicalia по периметру оз. Байкал и анализе микроэволюционных процессов, обеспечивающих высокое видовое разнообразие байкалий. Согласно поставленной цели были сформулированы следующие задачи:

1) Исследование генетического полиморфизма видов рода Baicalia по фрагментам митохондриальных и ядерных ДНК.

2) Установление филогенетических взаимоотношений вида Bcarinata с другими видами рода Baicalia по результатам сравнения последовательностей митохондриального гена СО1 и ядерного спейсера – ITS1.

3) Определение пространственно-генетической неоднородности в рамках вида Baicalia carinata в зависимости от районов озера.

4) Сравнение характера молекулярной эволюции у сестринских видов рода Baicalia по митохондриальному и ядерному молекулярным маркерам.

5) Сравнение морфологической и генетической изменчивости Bcarinata.

Научная новизна. Впервые в результате проведенной работы с помощью методов молекулярного анализа подробно исследована пространственно-генетическая неоднородность эндемичного байкальского вида Bcarinata. Установлено подразделение вида как минимум на две популяции: Юго-Западную и Восточную.

Использование рангового критерия Манна и Уитни подтвердило статистическую достоверность различий между выделенными популяциями по молекулярно-генетическим данным.

Исследованы филогенетические взаимоотношения внутри рода Baicalia. Установлено, что B. carinata является предковым видом по отношению к остальным видам этого рода.

Проведено сравнение характера молекулярной эволюции у сестринских видов рода Baicalia по митохондриальному и ядерному молекулярным маркерам. Выявлено различие по скоростям накопления замен между сестринскими видами в митохондриальной ДНК.



Практическое значение работы. Полученные результаты могут быть использованы для моделирования макро- и микроэволюционных процессов формирования репродуктивной изоляции и видового разнообразия. Наработанные данные могут помочь в развитии общей теории видообразования эндемичных брюхоногих моллюсков озера Байкал.

Нуклеотидные последовательности фрагмента гена СО1 мтДНК депонирована в GenBank с номерами доступа: DQ436347-DQ436441.

Материалы диссертационной работы должны быть привлечены при проведении таксономической ревизии семейства Baicaliidae.

Результаты проведенных исследований используют в курсе лекций по генетике на биолого-почвенном факультете Иркутского Государственного Университета.



Апробация работы и публикации. Материалы диссертации докладывались на Международной конференции «Molluscs of the Northeastern Asia and Northern Pacific: Biodiversity, Ecology, Biogeography and Faunal History». Владивосток, 2004. На Четвертой Верещагинской Байкальской конференции. Иркутск, 2005. На пятой международной конференции «International conference on Bioinformatics of Genome regulation and Structure». Новосибирск, 2006. На всероссийской научной конференции «Структура и экспрессия митохондриального генома растений». Иркутск, 2006. На четвертой международной конференции «Speciation in Ancient Lakes, SIAL IV» Берлин, Германия, 2006. На Международном Малакологическом Конгрессе, Антверпен, Бельгия, 2007.

По материалам диссертации опубликовано 10 работ из них 3 в рецензируемых журналах.



Структура и объем диссертации. Работа включает следующие разделы: введение, литературный обзор, материалы и методы, результаты и обсуждение, заключение, выводы и список используемой литературы (181 источник). Диссертация изложена на 118 страницах, содержит 39 рисунков и 6 таблиц.
МАТЕРИАЛЫ И МЕТОДЫ
Сбор моллюсков осуществляли с помощью драги и водолазами с глубины 10-40 метров в 30 районах Байкала (табл. 1) во время летних экспедиций 2003-2006 гг. Сразу после разбора бентосной пробы моллюсков фиксировали 80% этиловым спиртом, через сутки меняли фиксатор на 70% спирт.
Таблица 1. Районы сбора и количество расшифрованных нуклеотидных последовательностей по фрагментам CO1 и ITS1.


Место сбора

Фрагмент гена СО1

Фрагмент ITS1

Пос. Большие Коты

4

-

Бухта Варначка

4

4

Бухта Песчаная

9

2

Малое море, залив Тутайский

7

-

М. Боро-Елга

-

5

Пролив Ольхонские Ворота

16

6

Малое море, губа Семисосенная

7

4

М. Крест

6

4

М. Арал

1

-

Губа Большая Коса

2

-

Губа Богучанская

2

3

Середина о. Ярки

5

6

Губа Дагарская

3

1

Губа Аяя

2

3

М. Понгонье

6

7

Губа Иринда

2

6

Губа Якшакан

3

6

Бухта Сорожья

4

2

Чивыркуйский залив, напротив р. Большой Чивыркуй

5

5

Чивыркуйский залив, напротив р. Малая Сухая

2

3

В р-не о. Лиственичный

3

9

М. Тонкий

4

4

Между м. Тонкий и м. Туркинский

3

3

Губа Таланка

3

9

Около бухты Гремячинск

7

-

Около пос. Танхой

4

-

Муринская Банка

7

3

Около пос. Утулик

3

5

Около пос. Култук

1

2

М. Половинный

4

4

Около г. Байкальск

-

3

Всего

129

109


Экстракция ДНК. ДНК экстрагировали по модифицированному методу Дойла и Диксона (Doyle J.J., Dickson E., 1987) или методу Соколова (Sokolov E.P., 2000).

Амплификация ДНК. Амплификация фрагмента гена СО1 производилась методом ПЦР с использованием пары универсальных для беспозвоночных праймеров, фланкирующих фрагмент ДНК размером 710 п.н. (Folmer, 1994) и имеющих следующую структуру: L1490: 5′ - GGTCAACAAATCATAAAGATATTGG - 3′;

H2198: 5′ - TAAACTTCAGGGTGACCAAAAAATCA - 3′

Амплификацию фрагмента ITS1 проводили методом ПЦР, при помощи праймеров КР-2 (Salim and Maden, 1981) и 5,8S (Nazar and Roy, 1978), имеющих следующую структуру: ITS1 KP-2: 5′ - AAAAAGCTTCCGTAGGTGAACCTGCG - 3′;

ITS1 5,8S: 3′ - AGCTTGGTGCGTTCTTCATCGA - 3′



Определение нуклеотидных последовательностей. Прямое секвенирование двухцепочечных продуктов амплификации проводилось на автоматическом секвенаторе модели 373А фирмы “Applied Biosystem Inc.” с набором реактивов “Thermo Sequenase II dye terminator cycle sequencing kit” фирмы “Amersham pharmacia biotech”, а также на автоматическом секвенаторе CEQ 8800 (Beckman Coulter Inc.) с набором реактивов “Dye Terminator Cycle Sequencing with Quick Start Kit” фирмы “Beckman Coulter”, при помощи тех же праймеров (L1490 и H2198; Кр-2 и 5,8S).

Морфометрия. Все раковины моллюсков в рамках каждого сбора были измерены и сфотографированы, на основе чего создана компьютерная база данных. Промеры проводили с помощью бинокуляра, и только в случае очень крупных раковин использовали штанген-циркуль. Раковины измеряли по стандартной схеме (Жадин, 1952), дополненной измерениями ширины и высоты каждого из пяти оборотов, расположенных над устьем. Для статистического анализа данных использовали программы Excel и Statistica 6.0. Для оценки степени дивергенции между группами Bcarinata вычисляли коэффициент Майра, определяемый как разность средних значений признаков в сравниваемых популяциях, деленная на сумму среднеквадратических отклонений (Майр, 1971).

Компьютерная обработка данных. Выравнивание нуклеотидных последовательностей СО1 и ITS1 проводилось с помощью программы BioEdit (Hall, 1999). Генетические расстояния между нуклеотидными последовательностями оценивали с помощью двухпараметрической модели Кимуры (Kimura, 1980) для чего использовали программу DNADist из пакета программ Phylip (Felsenstein, 1996). Филогенетические древа строили методом максимального правдоподобия (Maximum Likelihood, ML) (Felsenstein, 1981) с помощью программы Phyml (Bevan, et al 2005) и баесовским методом, программой MrBayes (Ronquist, Huelsenbeck, 2003). Популяционные параметры θ0 и g вычисляли с помощью программы FLUCTUATE из пакета программ LAMARC (Kuhner et al., 1995). θ0 - характеризует размер популяции и описывается формулой θ0=4Neμ, где Ne – эффективная численность популяции, μ - скорость накопления мутаций на сайт за поколение. Скорость изменения θ описывается выражением dθ/dt= θ0egt Параметр g (growth) характеризует изменение численности популяции и определяется как g=[t-1].

Для изучения популяционной структуры строили простирающиеся древа методом максимальной экономии (Maximum Parsimony, MP) с помощью программы NetWork (Bandelt et al., 1995; Bandelt et al., 1999).

Для оценки достоверности генетических отличий между выделенными нами популяциями использовали критерий Манна и Уитни.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Исследование нуклеотидных последовательностей CO1 и ITS1


В ходе исследования нуклеотидные последовательности фрагмента митохондриального гена СО1 длиной 588 п.н. определены для 109 представителей B. carinata, собранных из 29 районов озера Байкал и для 20 представителей близкородственных видов Bcarinatocostata, Bcarinata rugosa, Bturriformis (табл.1). Последовательности частично депонированы в GenBank, номера доступа DQ436347 - DQ436441.

Для всех нуклеотидных последовательностей установлена единственная и непрерывная рамка считывания, проведена проверка на отсутствие стоп-кодонов.

В пределах вида B. carinata содержится по фрагменту CO1 обнаружен 31 вариабельный сайт. Из всех выявленных вариабельных сайтов 27 содержат только транзиции, а 5 - трансверсии, несинонимичных замен – 1. Внутри рода Baicalia выявлено 60 вариабельных сайтов из них содержащих транзиции - 46, трансверсии - 16, несинонимичных замен – 3. Среди всех нуклеотидных последовательностей по фрагменту мтДНК обнаружено 59 уникальных гаплотипов.

Нуклеотидные последователь-ности фрагмента ITS1 ядерной ДНК длиной 360 п.н. определены для 95 представителей B. сarinata, собранных из 25 районов о. Байкал и 14 представителей близкородственных видов: B. carinatocostata, B. turriformis, Bcarinata rugosa, B. dybowskiana carinatoides (табл.1).

Из всех исследованных нуклеотидных последовательностей по фрагменту ядерной ДНК 52 - уникальных.
Изучение популяционного полиморфизма B. carinata по митохондриальному маркеру

Исследование пространственно-генетической структуры Bcarinata мы проводили с помощью простирающегося древа, построенному по фрагменту гена СО1 мтДНК методом максимальной экономии (Maximum Parsimony, MP).

На простирающемся древе, построенном на основе нуклеотидных последовательностей фрагмента митохондриального гена СО1 видно, что все исследованные улитки B. carinata формируют две группы, связанные между собой одной достаточно длинной веткой и соответствующие двум большим географическим ареалам: восточный берег Байкала (от губы Аяя до Танхоя) и западный берег, включая весь Южный Байкал (от Муринской Банки до о. Ярки), которые мы назвали Восточной и Юго-Западной популяциями соответственно (рис. 1). На древе также хорошо видно, что все сестринские виды образуются в его разных частях от вида Bcarinata и формируют самостоятельные, четко различимые клады. То же касается и Bcarinata rugosa, таксономический статус которого в настоящее время не ясен. Это свидетельствует о том, что исследуемый нами вид B. carinata является предковым для всех других видов рода Baicalia.

Рис. 1. Простирающееся древо, построенное на основе фрагмента гена СО1 мтДНК методом максимальной экономии. Разными цветами обозначены популяции вида B. carinata и его близкородственные виды.
Для более подробного исследования особенностей эволюции каринат, построили филогенетическое древо методом максимального правдоподобия (Maximum Likelihood, ML), с помощью программы Phyml (Bevan et al., 2005) для набора расшифрованных нуклеотидных последовательностей фрагмента гена СО1, принадлежащим особям вида Bcarinata. В качестве аутгрупп выбрали один из сестринских видов – Bcarinatocostata, а также один из самых далеко отстоящих видов по отношению к каринатам – Pseudobaicalia elegantula из сем. Baicaliidae.

Как и на простирающемся, на филогенетическом древе, построенном на основе последовательностей СО1, полученных в рамках данного исследования и взятых из GeneBank (номера доступа Z92986, Z92992) для других видов семейства Baicaliidae видно, что B. carinata также распадается на две клады по местообитанию: Восточную и Юго-Западную (рис. 2 А). Первая клада включает в себя моллюсков из Чивыркуйского залива, Гремячинска, м. Понгонье, о. Лиственничный, губы Таланка и м. Тонкого (Восточная популяция). Во вторую кладу входят представители, населяющие пос. Култук, пос. Утулик, Муринскую Банку, пос. Большие Коты, б. Песчаная, пролив Ольхонские Ворота, б. Тутайская, губа Семисосенная, о. Ярки (Юго-Западная популяция). Границы популяций и их локализация по периметру оз. Байкал, в соответствии с полученными молекулярно-филогенетическими данными показаны на рис. 2Б.







А Б
Рис. 2. А. Молекулярно-филогенетическое древо, построенное методом максимального правдоподобия по двухпараметрической модели Кимуры, на основе нуклеотидных последовательностей мтДНК фрагмента гена СО1. Бутстрепные поддержки приведены только для значимых узлов. Курсивом выделены другие виды сем. Baicaliidae. Б. Географическая дифференциация вида Baicalia carinata в озере Байкал.
Анализ внутригруппового распределения попарных генетических дистанций для Восточной популяции показал, что наибольшее число последовательностей отличаются одним процентом замен (общее количество вариабельных сайтов равно шести), тогда как для Юго-Западной популяции эта цифра возрастает до 4,6% замен (27 вариабельных сайтов). То есть, по сравнению с крайне полиморфной Юго-Западной группой улиток, Восточная популяция достаточно однородна и имеет небольшой размах по генетическому полиморфизму. На графике межгруппового распределения попарных генетических дистанций видно, что область наиболее часто встречающихся последовательностей смещена в сторону больших генетических дистанций, это свидетельствует о том, что мы имеем дело с разными популяциями (рис. 3).


Рис. 3. Графики попарного распределения генетических расстояний внутри и между группами. X – попарное распределение генетических расстояний (% замен), Y – вероятность встречаемости двух последовательностей с одинаковыми генетическими расстояниями.
Для обеих популяций оценили важнейшие параметры θ0 и g, характеризующие популяции (табл. 2).

Таблица 2. Значение параметров θ0 и g для двух популяций




θ0

g

Восточная популяция

0,0054

360,44

Юго-Западная популяция

0,0306

81,98



Полученные данные свидетельствует о том, что Восточная популяция при относительно небольшом эффективном размере численности и генетической однородности (параметр θ0 равен 0,0054) очень быстро растет, то есть ее эффективный размер постоянно возрастает (параметр g равен 360,44). В то время как Юго-Западная популяция при большем эффективном размере и генетической вариабельности (θ0 составляет 0,0306) растет довольно медленно (параметр g равен 81,98). Такой результат объясняется тем, что восточный берег, как правило, песчаный и пологий, больше пригоден для жизни этих улиток, чем крутое западное побережье, где песчаные пляжи прерываются выходами скал.
Изучение популяционного полиморфизма B. carinata по ядерному маркеру

Далее, построили простирающееся древо на основе нуклеотидных последовательностей внутреннего транскрибируемого спейсера ITS1 (рис. 4).

В отличие от простирающегося древа по фрагменту СО1, где каринаты образуют две отдельные группы, соединенные одной ветвью (рис. 1), по ядерному маркеру такого четкого разделения на популяции нет. Заметна лишь тенденция к разделению Bcarinata на группы, но эти группы перекрываются и связаны между собой более чем одной ветвью.

Рис. 4. Простирающееся древо, построенное на основе межгенного спейсера ITS1 яДНК методом максимальной экономии (Maximum Parsimony). Разными цветами обозначены популяции вида B. carinata и его близкородственные виды.
Точно также, как и для фрагмента гена СО1, кроме сетчатого древа мы построили еще и филогенетическое (рис. 5). В качестве аутгруппы использовали тот же самый близкородственный каринатам вид, что и для митохондриального древа - B. carinatocostata.

Фрагменты ITS1 содержат разные по длине вставки и делеции, поэтому мы использовали два особых способа для построения филогенетического древа. Первый из них заключается в том, что из последовательностей удаляются все сайты, содержащие делеции или вставки и филогенетическое древо сроится только с учетом нуклеотидных замен. В качестве модели генетических дистанций использовали двухпараметровую модель Кимуры (Kimura, 1980). Для построения другого филогенетического древа мы предположили, что вставки и делеции, подобно точечным заменам несут важную информацию об истории эволюционного процесса, поэтому имеющиеся последовательности представили в виде двухбуквенной записи, где одной буквой обозначили все нуклеотидные основания, другой – все делеции. Поскольку в таком наборе данных могут происходить замены только одного типа (одной буквы на другую), то в качестве модели генетических дистанций использовали модель Джукса-Кантора (Jukes, Cantor, 1969). Древа, полученные в результате применения обеих процедур, по топологии существенно не различались, и на них невозможно выделить клады, соответствующие географическим районам Байкала.



Рис. 5. Молекулярно-филогенетическое древо, построенное методом максимального правдоподобия по двухпараметрической модели Кимуры, на основе нуклеотидных последовательностей яДНК фрагмента ITS1 только с учетом мутаций. Курсивом выделен другой вид сем. Baicaliidae.
Этот результат можно объяснить двумя фактами. Во-первых, даже некодирующие ядерные маркеры эволюционируют медленнее, чем кодирующие гены митохондриальной ДНК (Минченко, Дударева, 1990; Корниенко и др., 2004). Во-вторых, согласно теории нейтральной молекулярной эволюции (Кимура, 1985), для фиксации нейтральной замены в популяции требуется некоторое время, в среднем это время, в количестве поколений, составляет четыре эффективных размера популяции. Эффективный размер популяции для митохондриального генома, по меньшей мере, в четыре раза меньше эффективного размера популяции ядерного генома. Это связано с тем, что митохондриальные гены наследуются только в одной копии и только по материнской линии. То есть, в этой ситуации, за один и тот же промежуток времени в количестве поколений, прошедших с момента деления исследуемого вида на популяции, в митохондриальном геноме могло зафиксироваться множество мутаций, а в ядерном геноме - ни одной. Этим и объясняется различие между деревьями, построенным по митохондриальному и ядерному маркерам.

Оценка достоверности генетической неоднородности Baicalia carinata


Для оценки достоверности отличий между популяциями, выделенными с помощью молекулярно-филогенетического анализа, мы использовали ранговый критерий Манна и Уитни (U-критерий) (Mann, Whitney, 1947; Лакин, 1990). Данный критерий использовался в ряде работ, для анализа попарных генетических дистанций (Uit de Weerd et al., 2004; Ingman, Gyllensten, 2003). Вычислили величину z, значение которой равно 20893679, что намного больше табличного значения , следовательно р≤0,01. Это свидетельствует о том, что сравниваемые нами группы выборок (Восточная и Юго-Западная популяции) достоверно отличаются друг от друга. Для ядерного маркера р≤0,05. Это подтверждает результат, полученный при филогенетическом анализе, проведенном по этому же маркеру.

Известно, что песчаные грунты в западной и восточной литорали Байкала неравномерны, расположены пятнами и прерываются каменисто-валунными грядами и выходами скал (Kozhova, Izmest’eva, 1998). И можно было ожидать существование множества популяций, в предельном случае – по одной в каждом таком «пятне». Однако результаты проведенного молекулярно-генетического анализа свидетельствуют о том, что, несмотря на пространственную раздробленность ареала распространения исследуемого вида моллюска вдоль литорали озера, между пространственно изолированными группами животных происходит обмен генетической информацией.

По предварительным наблюдениям выяснено, что особи вида B. carinata передвигаются по поверхности мягкого субстрата, а не проводят большую часть жизни, зарывшись в грунт, как, например, виды родов Korotnewia Lindholm, 1909 и Liobaicalia Lindholm, 1924. Поэтому широкое расселение исследуемого вида по озеру вполне возможно, к тому же, если учесть, что B. carinata откладывает яйца на раковины особей своего вида, то имеет место и активное расселение (улитки), и пассивное (эмбрионы) (Sitnikova et al., 2001), что определяет большую скорость передачи генетической информаций у исследуемых моллюсков.

Филогенетические взаимоотношения внутри рода Baicalia





Рис. 6. Филогенетическое древо, построенное баесовским методом по ядерной ДНК некодирующего региона ITS1. Узлы с постериорными вероятностями менее 50% сведены в политомии. Разными цветами выделены все виды рода Baicalia.
На простирающихся древах (рис. 1, 4) видно, что байкалии, как уже отмечалось выше, формируют самостоятельные клады и образуются в разных частях этих древ от вида Bcarinata. Это свидетельствует в пользу того, что вид Bcarinata может быть предковым для остальных видов рода Baicalia. Если соотносить простирающиеся древа с географией Байкала, то можно сказать, что формы Bcarinatocostata, B. turriformis образовались на восточном побе-режье, а Bc. rugosa, Bdybowskiana - на западном и дальше их эволюция происходила параллельно.

Для того чтобы получить более целостную картину о филогении сестринских видов байкалий мы построили филогенетические древа по обоим маркерам «баесовским методом» с помощью программы MrBayes (Ronquist, Huelsenbeck, 2003). В качестве аутгруппы выбрали вид Benedictia baicalensis, принадлежащий эндемичному семейству байкальских моллюсков Benedictiidae. Сравнивая филогенетические древа, построенные по двум молекулярным маркерам, мы установили, что все виды рода Baicalia, так же как и на простирающихся древах, образуют самостоятельные клады. Однако, следует обратить внимание, что на молекулярно-филогенетическом древе, построенному по ядерному маркеру все сестринские виды, в том числе и B. c. rugosa, и Bdybowskiana стоят достаточно далеко от B. carinata и выступают аутгруппой ко всем каринатам (рис. 6).

Напротив, на митохондриальном древе, построенном аналогичным методом и приведенном ниже, видно, что ругозы и другие сестринские виды фактически не отделяются и даже встраиваются внутрь, «разбивая» клады B. carinata (рис. 7).





Рис. 7. Филогенетическое древо, построенное баесовским методом по фрагменту гена СО1 мтДНК. Узлы с постериорными вероятностями менее 50% сведены в политомии.

Анализируя полученные результаты, мы получили следующий факт. Несмотря на то, что ядерный геном эволюционирует в целом гораздо медленнее митохондриального (в нашем случае среднее количество нуклеотидных замен внутри вида по ядерному маркеру составляет около 2%, а по митохондриальному – около 5%), встречаются отдельные случаи, когда наблюдаемый уровень полиморфизма в ядерной ДНК оказывается выше, чем в митохондриальной (межвидовой полиморфизм рода Baicalia по ядерному маркеру составляет 6%, а по митохондриальному – около 4,5%). Это может быть связано с тем, что при неизменной скорости накопления замен в одном маркере, скорость эволюции в другом маркере может меняться. Для проверки данной гипотезы мы провели тест на относительную скорость эволюции (Relative Rate Test) и сравнили поочередно каждый вид из исследуемого рода с самым широко распространенным представителем байкалий – видом B. carinata (рис. 8).

По результатам проведенного теста видно, что скорость молекулярной эволюции по участку ядерной ДНК среди байкалий приблизительно одинакова, тогда как по митохондриальному маркеру эта скорость довольно сильно варьирует. То есть, при неизменной скорости накопления замен в маркере яДНК, скорость накопления замен в мтДНК достоверно отличается. Причем, моллюски, имеющие по результатам теста, самую высокую и самую низкую скорость накопления замен резко отличаются по экологическим характеристикам, в частности по субстратной приуроченности. Самая высокая скорость эволюции у вида B. carinatocostata, который, как и B. carinata, живет и размножается на песчаных грунтах, но в отличие от B. carinata, откладывающей яйца на раковины особей своего вида, особи B. carinatocostata прикрепляют яйцевые капсулы на песчинки. Затем, по результатам теста следуют B. c. rugosa и B. dybowskiana, встречающиеся совместно с B. carinata на мягких грунтах, но их яйца были найдены только на каменисто-валунных грунтах литорали. Самая низкая скорость эволюции у B. turriformis, для которого характерным местом обитания являются скальные выходы материнских пород и боковые поверхности огромных валунов (Sitnikova et al., 2001).





Рис. 8. По оси Y – среднее число замен в процентах между B. carinata и видами рода Baicalia, по оси X – виды рода Baicalia.
Такое замедление молекулярной эволюции можно объяснить эффектом «митохондриального подметания» (MacRae, Anderson, 1988; Ballard et al., 1996; Shoemaker et al., 2004; Wisea et al., 1998; Opijnen et al., 2005; Árnason, 2004; Grant et al., 2006). Этот эффект заключается в том, что если в любом митохондриальном гене происходит благоприятная мутация, то гаплотип, несущий эту мутацию, получает преимущество и очень быстро становится преобладающим в популяции, вытесняя другие гаплотипы. Обязательным условием возможности такого «подметания» является отсутствие рекомбинации. Результатом станет снижение уровня наблюдаемого генетического полиморфизма митохондриальной ДНК, тогда как уровень генетического полиморфизма в ядерной ДНК останется прежним.

Таким образом, можно предположить, что появлению форм Bc. rugosa и B. dybowskiana способствовали какие-то благоприятные мутации, связанные с изменением образа жизни (например, с измением физиологических потребностей в кислороде) и произошедшие именно в митохондриальном геноме. Как следствие, снизился уровень генетического полиморфизма мтДНК, а полиморфизм ядерного генома остался прежним, что объясняет различное положение B. c. rugosa и Bdybowskiana на ядерном и митохондриальном филогенетических древах.


Морфологическая дифференциация B. carinata по пластическим признакам


В рамках проведенного исследования измерено 450 раковин моллюсков, принадлежащих виду B. carinata, собранных из 35 районов оз. Байкал. Весь массив данных разделили географически на две группы: Восточную (237 раковин) и Юго-Западную (213 раковин) популяции согласно генетическим данным и проверили достоверность отличий с помощью критериев Стьюдента и Фишера (Лакин, 1990) (табл. 3). Предварительно, морфологические признаки проверили на нормальность распределения. Коэффициент корреляции между пластическими признаками по H и W равен 0,75. Это говорит о том, что все измеряемые нами морфологические признаки коррелируют между собой в зависимости от размеров раковины.

Из проведенного анализа следует, что при достоверном отличии двух исследуемых групп моллюсков с вероятностью более 99% по критериям Стьюдента и Фишера, коэффициент дивергенции Майра (Майр, 1971), показывающий степень отличий между группами очень мал. Сравниваемые популяции могут считаться самостоятельными подвидами, если коэффициент Майра CD≥1,28. В нашем случае практически все значения CD меньше 1,28, что соответствует различиям на внутривидовом уровне.


Таблица 3. Статиститческая оценка дифференцированности B. carinata.


Пласти

ческие призна

ки



Восточная популяция

(n=237)

Юго-Западная популяция

(n=213)

Крите-

рий Стью-

дента


Вероят-ность (pSt)

Крите-

рий


Фишера

(F-ratio)



Вероят-ность (pF)

CV

(%)


CD

Сред-

нее


значе-

ние




Стан-дарт-

ное откло-

нение


Сред-нее значе-ние

Стандар-

тное отклоне-



ние

H

15,77

3,32

12,53

1,98

12,40

<0,0001

2,80

<0,0001

21

0,61

W

5,81

1,00

4,59

0,66

15,10

<0,0001

2,31

<0,0001

17

0,74

Ah

4,16

0,84

3,45

0,61

10,13

<0,0001

1,87

<0,0001

20

0,49

Aw

3,21

0,61

2,59

0,38

12,94

<0,0001

2,51

<0,0001

19

0,63

h1+ha

7,20

1,27

5,93

0,92

12,00

<0,0001

1,91

<0,0001

17

0,58

h1

3,10

0,57

2,68

0,43

8,92

<0,0001

1,76

<0,0001

19

0,43

h2

2,48

0,50

2,11

0,37

8,83

<0,0001

1,80

<0,0001

20

0,42

h3

1,94

0,40

1,65

0,30

8,46

<0,0001

1,74

<0,0001

21

0,41

w1

5,20

0,89

4,16

0,64

14,03

<0,0001

1,95

<0,0001

17

0,68

w2

4,17

0,78

3,33

0,53

13,18

<0,0001

2,19

<0,0001

19

0,64

w3

3,30

0,72

2,64

0,45

11,54

<0,0001

2,59

<0,0001

21

0,57

N

6,47

1,02

5,88

0,87

6,56

<0,0001

1,36

0,0243

15

0,31


Н - высота раковины, W - ширина раковины, Ah - высота устья, Aw -ширина устья, h1+ha - высота устья и первого оборота, h1 - высота первого оборота над устьем, h2, h3 - высота каждого последующего оборота, w1 – ширина первого оборота, w2, w3 – ширина каждого последующего оборота, N – количество оборотов, n – количество особей. CD – коэффициент отличий между двумя группами организмов (самое высокое значение коэффициента выделено жирным шрифтом).
Далее мы проанализировали полученный массив данных по морфологическим признакам, с помощью метода главных компонент и получили диаграмму распределения групп особей Bcarinata (рис. 9А). Для построения графика мы использовали средние значения по всем морфометрическим признакам для улиток собранных в разных районах оз. Байкал (рис. 9Б). На полученном рисунке точки обозначили в соответствии с географическими границами вида B. carinata, определенными по молекулярно-генетическим данным. По проведенному исследованию видно, что по фенотипической изменчивости все измеренные моллюски образуют две группы, географически расположенные на Восточном и Западном берегах оз. Байкал, но их границы сильно перекрываются.

Морфологическая изменчивость раковин моллюсков из различных районов литоральной зоны оз. Байкал не коррелирует с генетической, и зависит не только от географического местонахождения, а также от экологических факторов, таких как тип субстрата, глубина местообитания. Зависимость формирования раковины от экологических условий показывает расположение некоторых точек на диаграмме распределения раковин B. сarinata в плоскости двух главных компонент. Например, точки 17 и 18 принадлежат одному географическому району – губе Семисосенной, но взяты на разных глубинах и с разных грунтов, в результате, на графике они расположены далеко друг от друга. Приведем обратный пример, когда особи, собранные из географически удаленных районов в плоскости двух главных компонент оказываются рядом. К такому случаю можно отнести расположение на графике точек 22 (губа Иринда) и 9 (около пос. Танхой), географически удаленных друг от друга, но собранных на примерно одной и той же глубине и схожем типе грунта.


А Б




Рис. 9. А. Диаграмма распределения моллюсков B.carinata в плоскости двух главных компонент по морфометрическим признакам. Кружками обозначена Юго-Западная популяция, квадратиками – Восточная. Б. Районы сбора образцов, использованные для морфологического анализа.

Таксономический статус Baicalia carinata rugosa, Lindh 1909


Вид Baicalia carinata является полиморфным по своей структуре и отличается большим разнообразием формы и скульптуры раковины. В начале 20-го века было описано около 10 внутривидовых форм B. carinata (Dybowski, Grochmalicki, 1914; Lindholm, 1909). Среди них была форма Baicalia carinata rugosa, описанная Линдгольмом в 1909 году. Позже Кожов (1936) описал выделенные предыдущими авторами вариететы как экологические формы одного вида. Только для одной из форм, отличающейся от других наличием слабо выраженных поперечных складок на раковине, Кожов (1936) предложил сохранить подвидовое название Baicalia carinata rugosa, данное Линдгольмом (1909). С тех пор таксономический статус B. carinata больше не менялся.

В ходе проведенного исследования мы подробно изучили генетический полиморфизм вида B. carinata. На основе анализа простирающихся и филогенетических древ мы установили, что подвид B. c. rugosa всегда формирует самостоятельные клады, хорошо отличимые от остальных каринат. Кроме того, уровень генетических отличий между каринатами и ругозами составляет около 5% нуклеотидных замен по фрагменту СО1 митохондриальной ДНК и порядка 4,5% замен по участку ITS1 ядерной ДНК, что соответствует уровню межвидовых отличий. Также необходимо отметить, что генетический маркер ITS1 успешно применяется для различения близкородственных видов или видов двойников, поскольку содержит в своих последовательностях видоспецифические вставки и делеции. При сравнении наборов расшифрованных нуклеотидных последовательностей, мы установили, что B. c. rugosa как и остальные близкородственные виды содержит в своих последовательностях ряд вставок, характерных только для этой группы.

Все выше перечисленные факты свидетельствуют в пользу того, что подвид B. c. rugosa является самостоятельным видом.

Таким образом, по результатам проведенного молекулярно-филогенетического исследования мы предлагаем повысить таксономический статус B. c. rugosa до вида.



ВЫВОДЫ


  1. Проведен анализ генетического полиморфизма у байкальских эндемичных брюхоногих моллюсков рода Baicalia, Martens, 1876. Получены и проанализированы 129 нуклеотидных последовательностей фрагмента митохондриального гена СО1 длиной 588 п.н. и 109 нуклеотидных последовательностей ядерного фрагмента ITS1 длиной 360 п.н. у всех видов этого рода, отобранных в тридцати пунктах по всему периметру Байкала.

  2. Филогенетический анализ нуклеотидных последовательностей фрагмента гена СО1 мтДНК и межгенного ядерного спейсера ITS1 позволил установить, что B. carinata формирует две географически непрерывные и неперекрывающиеся группы - Восточную и Юго-Западную популяции. Северная граница между популяциями проходит в районе дельты р. Верхняя Ангара, южная - между п. Танхой и Муринской банкой на Юго-Восточном берегу Байкала.

  3. Исследование генетических взаимоотношений гаплотипов рода Baicalia на основе минимального простирающегося древа, построенного методом максимальной экономии, показало, что вид B. carinata занимает центральное положение и является предковым для видов Bcarinatocostata, B. turriformis, B. dybowskiana и подвида B. c. rugosa.

  4. Анализ генетического разнообразия рода Baicalia позволил обнаружить параллельное видообразование, которое определяется экологическими условиями. Восточная популяция дала начало виду Bcarinatocostata, который обитает и размножается на песчаных грунтах, и виду B. turriformis, населяющему скалы и валуны. Юго-Западная популяция дала начало B. c. rugosa, B. dybowskiana, обитающим на песках и мигрирующим в период размножения на каменистые грунты.

  5. Выявлены статистически достоверные различия между Восточной и Юго-Западной популяциями Bcarinata по 15 морфологическим признакам. Обнаружена зависимость размеров раковин от экологических факторов (глубина и тип грунта).

  6. Установленная в рамках настоящей работы генетическая обособленность подвида B. c. rugosa от всех байкалий, с учетом того, что B. c. rugosa занимает уникальную экологическую нишу, позволяет считать этот таксон самостоятельным видом.



Список работ, опубликованных по теме диссертации:

  1. Самсонова Т.Е., Щербаков Д.Ю., Ситникова Т.Я. Популяционно-генетическое исследование комплекса видов Baicalia carinata (Mollusca, Pectinidranchia). Бюллетень ВСНЦ СО РАМН, 2003; (7):136-138.

  2. Peretolchina T.E., Sitnikova T.Ya., Sherbakov D.Yu. Genetic polymorphism in the Baicalia carinata species complex. Международная конференция «Molluscs of the Northeastern Asia and Northern Pacific: Biodiversity, Ecology, Biogeography and Faunal History». Vladivostok: Dalnauka, 2004. P. 134-135.

  3. Перетолчина Т.Е., Букин Ю.С., Ситникова Т.Я., Щербаков Д.Ю. Внутривидовой генетический полиморфизм комплекса видов Baicalia carinata. Четвертая Верещагинская Байкальская конференция. Иркутск. 2005. C. 151.

  4. Peretolchina T.E., Bukin Yu.S., Sitnikova T.Ya. Sherbakov D.Yu. Population genetic polymorphism of endemic mollusks Baicalia carinata (Mollusca, Caenogastropoda). «Fifth International conference on Bioinformatics of Genome regulation and Structure». Novosibirsk, 2006. P. 203-206.

  5. Перетолчина Т.Е., Щербаков Д.Ю. Исследование генетического полиморфизма вида Baicalia carinata (Mollusca, Caenogastropoda) на основе сравнения двух генетических маркеров: фрагментов митохондриального гена CO1 и ядерного некодирующего региона ITS1. Всероссийской научной конференции «Структура и экспрессия митохондриального генома растений». Иркутск, 2006. С. 83-84.

  6. Peretolchina T., Sitnikova T., Riedel F., Sherbakov D. Intraspecific structure of two species of Baikaliidae (Caenogastropoda, Rissooidea) from Lake Baikal. International conference «Speciation in Ancient Lakes, SIAL IV». Berlin, 2006. P. 49.

  7. Перетолчина Т.Е., Ситникова Т.Я., Щербаков Д.Ю. Исследование популяционного генетического полиморфизма эндемичного байкальского моллюска Baicalia carinata (Mollusca, Caenogastropoda). Ruthenica; 2006; 16(2): 105-111.

  8. Перетолчина Т.Е., Щербаков Д.Ю. Популяции байкальских эндемичных гастропод Baicalia carinata (Mollusca: Caenogastropoda) и их эволюционные связи с сестринскими видами. // Материалы конференции Современные проблемы биологической эволюции. К 100-летию Дарвиновского музея. Москва, Россия; 2007. С. 187-188.

  9. Peretolchina T.E., Sherbakov D.Yu., Sitnikova T.Ya. Populations of baikalian endemic mollusks Baicalia carinata (Mollusca, Caenogastropoda) end evolution relation with close related species. World Malacological Congress. Antwerpen, Belgium. P. 167.

  10. Перетолчина Т.Е., Букин Ю.С., Ситникова Т.Я., Щербаков Д.Ю. Генетическая дифференциация эндемичного байкальского моллюска Baicalia carinata (Mollusca, Caenogastropoda). Генетика; 2007; 43(12): 1667-1675.


Благодарности. Автор выражает искреннюю благодарность научному руководителю - д.б.н. Щербакову Д.Ю., а также к.б.н. Букину Ю.С., к.б.н. Кравцовой Л.С. за ценные консультации и поддержку на всех этапах подготовки диссертационной работы. Огромную благодарность автор выражает д.б.н. Ситниковой Т.Я. за помощь в систематике моллюсков и консультации при выполнении и оформлении диссертации, за сотрудничество в написании совместных статей и всестороннюю поддержку.

Исследование выполнялось при частичной поддержке гранта РФФИ, проекты №№ 02-04-63097б, 03-04-63102б, 04-04-48549-а, №№ 05-04-97246, 05-04-97258 и совместным российско-голландским проектом “Information system ‘Simulation and Analysis of Complex Histories of Evolution (SACHE)”, Ref. 047.016.013, а также гранта научной школы (НШ-2195.2003.4).







Смотрите также:
Микроэволюционные процессы в группе видов байкальских эндемичных гастропод рода baicalia (mollusca, caenogastropoda) 03. 00. 15 генетика
350.54kb.
1 стр.
Интродукция видов рода Callistemon R. Br на Южный берег Крыма
50.55kb.
1 стр.
Эколого-биологические особенности видов рода artemisia из подрода seriphidium
45.08kb.
1 стр.
История рода Ваньковичей и его роль в развитии белорусского искусства Федорчук Евгения Игоревна
32.24kb.
1 стр.
Эколого-биологические особенности некоторых видов рода pulsatilla mill. В условиях удмуртской республики >03. 02. 08 экология (биология) 03. 02. 01 ботаника
433.17kb.
1 стр.
Создание новых типов цигайских и каракульских овец в республике молдова с использованием генетических маркеров 06. 02. 01 Разведение, селекция, генетика и воспроизводство сельскохозяйственных животных 03. 00. 15 Генетика
617.75kb.
5 стр.
Исследование генетического разнообразия эпидемиологически значимых видов описторхид 03. 02. 07 генетика
249.08kb.
1 стр.
Наиболее эффективной мерой по сохранению эндемичных, редких и исчезающих видов растений и животных, уникальных и эталонных ландшафтов и природных экосистем является создание сети особо охраняемых природных территорий
145.78kb.
1 стр.
Характеристика сателлитных повторов видов aegilops L. Секции sitopsis и их использование в качестве молекулярных маркеров генетика 03. 00. 15
217.09kb.
1 стр.
Вопросы к коллоквиуму по дисциплине «Генетика и биометрия»
132.11kb.
1 стр.
Генетика пола Оборудование
181.53kb.
1 стр.
Терминальные районы хромосом у двух близкородственных видов бурозубок, Sorex granarius и sorex araneus ( soricidae, eulipotyphla) 03. 00. 15 генетика
276.01kb.
1 стр.